Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4491007
End position: 4491051
Length: 45

DNA sequence
>NC_016906, from 4491007 to 4491051 (45 bp); Gordonia polyisoprenivorans VH2 GGCGATCGGCCCAGAGGTGATCGGCCCAGGCCTGATCGGCCCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4489643-4492396	Sequence	GPOL_c39370 - LuxR family transcriptional regulator (Protein is coded in complementary strand; from 4492396 to 4489643)