Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4453783
End position: 4453827
Length: 45

DNA sequence
>NC_016906, from 4453783 to 4453827 (45 bp); Gordonia polyisoprenivorans VH2 TCCGGCTTCTGTGCTTCCGGGTTCTGAGTTTCCGGATTCTGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4453750-4453998	Sequence	GPOL_c39040 - hypothetical protein (Protein is coded in complementary strand; from 4453998 to 4453750)