Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4366516
End position: 4366560
Length: 45

DNA sequence
>NC_016906, from 4366516 to 4366560 (45 bp); Gordonia polyisoprenivorans VH2 CCGCCTCCCCGTCCTCCATCTCCCCGTCCTCCATCTCCCCGTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4365996-4367930	Sequence	GPOL_c38300 - putative carboxyl transferase (Protein is coded in complementary strand; from 4367930 to 4365996)