Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4334992
End position: 4335036
Length: 45

DNA sequence
>NC_016906, from 4334992 to 4335036 (45 bp); Gordonia polyisoprenivorans VH2 GTGGTCTCATGAAGAGTGGTCTCGTCAAAAGTGGTCTCGTCAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4332892-4335045	Sequence	GPOL_c38040 - putative beta-ketoacyl synthase (Protein is coded in complementary strand; from 4335045 to 4332892)