Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4317856
End position: 4317900
Length: 45

DNA sequence
>NC_016906, from 4317856 to 4317900 (45 bp); Gordonia polyisoprenivorans VH2 TGTCGGTCAGATCGCTGTCGGTCAGATCGCTGTCGGTCAGATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4316517-4318361	Sequence	GPOL_c37880 - putative AMP-dependent synthetase/ligase (Protein is coded in complementary strand; from 4318361 to 4316517)