Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4278741
End position: 4278785
Length: 45

DNA sequence
>NC_016906, from 4278741 to 4278785 (45 bp); Gordonia polyisoprenivorans VH2 GGTGTTGGGCGATCCGGTGTTCGGCGACCCGGCGTGCGGCGATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4277911-4278810	Sequence	GPOL_c37590 - carbon-nitrogen hydrolase family protein (Protein is coded in complementary strand; from 4278810 to 4277911)