Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4246780
End position: 4246824
Length: 45

DNA sequence
>NC_016906, from 4246780 to 4246824 (45 bp); Gordonia polyisoprenivorans VH2 CGGTCCAGCCCTGTTCTGTCGAGCCCTGATCTGTCGAGCCCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4246750-4248057	Sequence	GPOL_c37290 - putative glycosyltransferase (Protein is coded in complementary strand; from 4248057 to 4246750)