Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4243901
End position: 4243945
Length: 45

DNA sequence
>NC_016906, from 4243901 to 4243945 (45 bp); Gordonia polyisoprenivorans VH2 GTTGATCGGCATCGGGTTGTTCGGCATCGGGTTGTTCGACGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4240540-4244634	Sequence	GPOL_c37260 - WD-40 repeat-containing protein (Protein is coded in complementary strand; from 4244634 to 4240540)