Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4202382
End position: 4202426
Length: 45

DNA sequence
>NC_016906, from 4202382 to 4202426 (45 bp); Gordonia polyisoprenivorans VH2 GCTGGTGTTCTCTGGGCCGGTGTTGTCTGGGCTGATGTCTTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4202332-4204470	Sequence	GPOL_c36900 - putative acetyl-CoA carboxylase subunit alpha (Protein is coded in complementary strand; from 4204470 to 4202332)