Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4121283
End position: 4121327
Length: 45

DNA sequence
>NC_016906, from 4121283 to 4121327 (45 bp); Gordonia polyisoprenivorans VH2 CCTGCCGGCCCGGGTACTGCTGCCCCGGGTACTGCTGGCCCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4121249-4122379	Sequence	GPOL_c36170 - hypothetical protein (Protein is coded in complementary strand; from 4122379 to 4121249)