Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4092410
End position: 4092454
Length: 45

DNA sequence
>NC_016906, from 4092410 to 4092454 (45 bp); Gordonia polyisoprenivorans VH2 GGTCCCGTTGATCGCCGTGCCGTTGGTCGCAGTGCCGTTGGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4092360-4100639	Sequence	GPOL_c35920 - putative non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 4100639 to 4092360)