Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4052078
End position: 4052122
Length: 45

DNA sequence
>NC_016906, from 4052078 to 4052122 (45 bp); Gordonia polyisoprenivorans VH2 TGTCCCCATGCCTGTTGTCCCCGTGCCGGTTGTCCCTGTGCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4052050-4092363	Sequence	GPOL_c35910 - putative non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 4092363 to 4052050)