Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 397836
End position: 397880
Length: 45

DNA sequence
>NC_016906, from 397836 to 397880 (45 bp); Gordonia polyisoprenivorans VH2 CCACGTGCTGATCGGGCCCCTGCTGATCGGCCACCTGGTGTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 397790-398569	Sequence	GPOL_c03330 - hypothetical protein (Protein is coded in complementary strand; from 398569 to 397790)