Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3925092
End position: 3925136
Length: 45

DNA sequence
>NC_016906, from 3925092 to 3925136 (45 bp); Gordonia polyisoprenivorans VH2 CCCCGTCGGGTGCGGCCCCGTCGGGTGCGGCCCCGTCGGGTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3923779-3925158	Sequence	GPOL_c34890 - putative wax ester synthase/acyl-CoA:diacylglycerol acyltransferase (Protein is coded in complementary strand; from 3925158 to 3923779)