Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3869725
End position: 3869769
Length: 45

DNA sequence
>NC_016906, from 3869725 to 3869769 (45 bp); Gordonia polyisoprenivorans VH2 ATACCCCCGGCTCGAGTACCCCCGGCTCGAGTAGCTCCGGCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3869655-3870614	Sequence	GPOL_c34440 - putative oxidoreductase, short chain dehydrogenase/reductase family (Protein is coded in complementary strand; from 3870614 to 3869655)