Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3785550
End position: 3785594
Length: 45

DNA sequence
>NC_016906, from 3785550 to 3785594 (45 bp); Gordonia polyisoprenivorans VH2 ACTGCCCTGCGCCGATCTGCCCTGGGCCAATCTGCCCTGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3785165-3785614	Sequence	GPOL_c33660 - nitrite reductase (NAD(P)H) small subunit (Protein is coded in complementary strand; from 3785614 to 3785165)