Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3582472
End position: 3582516
Length: 45

DNA sequence
>NC_016906, from 3582472 to 3582516 (45 bp); Gordonia polyisoprenivorans VH2 TGCCCCGTGCCCGGTTGACGCGTGCCCGGTTGACGAGTGCCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3581546-3582538	Sequence	GPOL_c31750 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 3582538 to 3581546)