Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3454353
End position: 3454397
Length: 45

DNA sequence
>NC_016906, from 3454353 to 3454397 (45 bp); Gordonia polyisoprenivorans VH2 TCTCAGGTCGGTCGGTCTCAGGTCGGTCGGTCTGCGGGCGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3452867-3454411	Sequence	GPOL_c30470 pur8 puromycin resistance protein Pur8 (Protein is coded in complementary strand; from 3454411 to 3452867)