Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3384932
End position: 3384976
Length: 45

DNA sequence
>NC_016906, from 3384932 to 3384976 (45 bp); Gordonia polyisoprenivorans VH2 TGTGTCGTACCCCCGTGTGTCGTACCCCCGTGTGTCGTACCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3383297-3385081	Sequence	GPOL_c29780 yloV DAK2 domain-containing protein YloV (Protein is coded in complementary strand; from 3385081 to 3383297)