Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3369667
End position: 3369711
Length: 45

DNA sequence
>NC_016906, from 3369667 to 3369711 (45 bp); Gordonia polyisoprenivorans VH2 GTCGTCGTCGAGATGGGGGTCGTCGAGATGGGGGTCGTCGGGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3368879-3370075	Sequence	GPOL_c29650 - ComEA competence protein (Protein is coded in complementary strand; from 3370075 to 3368879)