Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3317731
End position: 3317775
Length: 45

DNA sequence
>NC_016906, from 3317731 to 3317775 (45 bp); Gordonia polyisoprenivorans VH2 TGGTCGTCACGTCGGTGATCATCGCGTCGGTGATCGTCACGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3317515-3318018	Sequence	GPOL_c29170 - cold shock protein (Protein is coded in complementary strand; from 3318018 to 3317515)