Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3186050
End position: 3186094
Length: 45

DNA sequence
>NC_016906, from 3186050 to 3186094 (45 bp); Gordonia polyisoprenivorans VH2 GAACCAGGGGCCACAGAGCCAGGAGACACAGAGCCGGGAGCCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3185342-3186862	Sequence	GPOL_c28060 - hypothetical protein (Protein is coded in complementary strand; from 3186862 to 3185342)