Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3153368
End position: 3153412
Length: 45

DNA sequence
>NC_016906, from 3153368 to 3153412 (45 bp); Gordonia polyisoprenivorans VH2 TGTCGCGGGACCGTCGTTCGCGGGACCGTCGTTCGCGGCACCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3151608-3153497	Sequence	GPOL_c27750 ftsW cell division protein FtsW (Protein is coded in complementary strand; from 3153497 to 3151608)