Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2962372
End position: 2962416
Length: 45

DNA sequence
>NC_016906, from 2962372 to 2962416 (45 bp); Gordonia polyisoprenivorans VH2 GCATCGTGAGCTGCGGCAACGTGAGCTGCGGCAACGTGAGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2962357-2963577	Sequence	GPOL_c26090 argD acetylornithine aminotransferase ArgD (Protein is coded in complementary strand; from 2963577 to 2962357)