Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2933338
End position: 2933382
Length: 45

DNA sequence
>NC_016906, from 2933338 to 2933382 (45 bp); Gordonia polyisoprenivorans VH2 TGGTCCCCGTGCCCCTGGTCCCCGTGCCCCTGGTCCCCGTGTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2932615-2933478	Sequence	GPOL_c25850 scpB segregation and condensation protein B (Protein is coded in complementary strand; from 2933478 to 2932615)