Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2821743
End position: 2821787
Length: 45

DNA sequence
>NC_016906, from 2821743 to 2821787 (45 bp); Gordonia polyisoprenivorans VH2 GGTCGCTTCCCGATCCGTCGCCGCCCGATCCGTCGCTGCCCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2821733-2822800	Sequence	GPOL_c24740 - putative ribonuclease (Protein is coded in complementary strand; from 2822800 to 2821733)