Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2770258
End position: 2770302
Length: 45

DNA sequence
>NC_016906, from 2770258 to 2770302 (45 bp); Gordonia polyisoprenivorans VH2 CGGGTGGACCCAGCCCGGGTGGACTCAGTCCTGGTGGCCCCAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2770191-2771288	Sequence	GPOL_c24280 - hypothetical protein (Protein is coded in complementary strand; from 2771288 to 2770191)