Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2690505
End position: 2690549
Length: 45

DNA sequence
>NC_016906, from 2690505 to 2690549 (45 bp); Gordonia polyisoprenivorans VH2 CGGGTCAGCTCGGCGTGGGTCAACTCGGTGCAGGTCAGTTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2684451-2692217	Sequence	GPOL_c23600 - putative non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 2692217 to 2684451)