Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2556727
End position: 2556771
Length: 45

DNA sequence
>NC_016906, from 2556727 to 2556771 (45 bp); Gordonia polyisoprenivorans VH2 CTTCCTGCCCACCGTCTTCCTGCCCACCGATTTCCTGCCCACCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2556672-2557145	Sequence	GPOL_c22610 - hypothetical protein (Protein is coded in complementary strand; from 2557145 to 2556672)