Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2411171
End position: 2411215
Length: 45

DNA sequence
>NC_016906, from 2411171 to 2411215 (45 bp); Gordonia polyisoprenivorans VH2 TTGTCGAGTCTGAGTTTGTCGAGTCTGAGTTTGTCGAGTCCGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2407271-2411335	Sequence	GPOL_c21220 hrpA ATP-dependent helicase HrpA (Protein is coded in complementary strand; from 2411335 to 2407271)