Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2306315
End position: 2306359
Length: 45

DNA sequence
>NC_016906, from 2306315 to 2306359 (45 bp); Gordonia polyisoprenivorans VH2 GCCGGTGAGTGCCGAGACGGTGAGTGCAAAGACGGTGAGCCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2305826-2306323	Sequence	GPOL_c20330 - putative acetyltransferase, GNAT family
ORF... 2306320-2308398	Sequence	GPOL_c20340 - putative magnesium chelatase subunit