Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1882368
End position: 1882412
Length: 45

DNA sequence
>NC_016906, from 1882368 to 1882412 (45 bp); Gordonia polyisoprenivorans VH2 GGCTCTGGGTGTCTCGGTCCCGGGTGTCTCGGTCCTGGGTGTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1881954-1882448	Sequence	GPOL_c16560 - hypothetical protein (Protein is coded in complementary strand; from 1882448 to 1881954)