Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1695184
End position: 1695228
Length: 45

DNA sequence
>NC_016906, from 1695184 to 1695228 (45 bp); Gordonia polyisoprenivorans VH2 ACGACAGCAGGGGTCACGACACCAGAGCTCACGACAGCAGTGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1693462-1695288	Sequence	GPOL_c14830 - putative major facilitator superfamily transporter
ORF... 1695213-1695881	Sequence	GPOL_c14840 - putative transmembrane protein (Protein is coded in complementary strand; from 1695881 to 1695213)