Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1442681
End position: 1442725
Length: 45

DNA sequence
>NC_016906, from 1442681 to 1442725 (45 bp); Gordonia polyisoprenivorans VH2 GTCGCCGGGGTACTGCTCCCCGGGATACTGCTCGCCCGGATACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1442646-1443542	Sequence	GPOL_c12450 - putative large conductance mechanosensitive channel protein (Protein is coded in complementary strand; from 1443542 to 1442646)