Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1250437
End position: 1250481
Length: 45

DNA sequence
>NC_016906, from 1250437 to 1250481 (45 bp); Gordonia polyisoprenivorans VH2 TCGTCGCAGGGGAATTCGTCGCAGGGGAATTCGTCGCAGGGGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1250301-1251323	Sequence	GPOL_c10900 - hypothetical protein (Protein is coded in complementary strand; from 1251323 to 1250301)