Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1072311
End position: 1072355
Length: 45

DNA sequence
>NC_016906, from 1072311 to 1072355 (45 bp); Gordonia polyisoprenivorans VH2 ACGGGTCCGGCGCTGAGGGGTCCGGCGCTGATGAGTCCGGCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1071137-1072372	Sequence	GPOL_c09210 - putative NADH-dependent flavin oxidoreductase (Protein is coded in complementary strand; from 1072372 to 1071137)