Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2241894
End position: 2241935
Length: 42

DNA sequence
>NC_016906, from 2241894 to 2241935 (42 bp); Gordonia polyisoprenivorans VH2 GACCGCCACACATCGACCACCACACACCGACCACCACACACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2241099-2241896	Sequence	GPOL_c19710 - putative amino acid ABC transporter ATP-binding protein