Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 706661
End position: 706696
Length: 36

DNA sequence
>NC_016906, from 706661 to 706696 (36 bp); Gordonia polyisoprenivorans VH2 GCGAGCCCACCGGCCAGTCCACCGGCGAGCCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 705278-708442	Sequence	GPOL_c05920 - putative integral membrane protein (Protein is coded in complementary strand; from 708442 to 705278)