Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3804432
End position: 3804467
Length: 36

DNA sequence
>NC_016906, from 3804432 to 3804467 (36 bp); Gordonia polyisoprenivorans VH2 TGTCGATGCGCGCGTCGGTGCGCGCGTCGGTGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3804209-3805747	Sequence	GPOL_c33840 - putative sensor histidine kinase (Protein is coded in complementary strand; from 3805747 to 3804209)