Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2614731
End position: 2614766
Length: 36

DNA sequence
>NC_016906, from 2614731 to 2614766 (36 bp); Gordonia polyisoprenivorans VH2 TGCGGTGTCGGCGGTGTCGGCGGTGTCTGCGGTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2614363-2616933	Sequence	GPOL_c23150 - putative non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 2616933 to 2614363)