Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2434347
End position: 2434382
Length: 36

DNA sequence
>NC_016906, from 2434347 to 2434382 (36 bp); Gordonia polyisoprenivorans VH2 GGTGGCCTTCTTGGCCGCCTTCTTGGCGGTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2433037-2434488	Sequence	GPOL_c21410 sigA RNA polymerase sigma factor SigA (Protein is coded in complementary strand; from 2434488 to 2433037)