Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 5587974
End position: 5588006
Length: 33

DNA sequence
>NC_016906, from 5587974 to 5588006 (33 bp); Gordonia polyisoprenivorans VH2 TTCGGTCACCGGGCGGTCACCGGGCGGTCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5588002-5589012	Sequence	GPOL_c49580 - MerR family transcriptional regulator (Protein is coded in complementary strand; from 5589012 to 5588002)