Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 793693
End position: 793722
Length: 30

DNA sequence
>NC_016906, from 793693 to 793722 (30 bp); Gordonia polyisoprenivorans VH2 CGCTGTCGCTGTCGGTGTCGGTGTCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 792492-793751	Sequence	GPOL_c06530 - putative HNH endonuclease (Protein is coded in complementary strand; from 793751 to 792492)