Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 622416
End position: 622445
Length: 30

DNA sequence
>NC_016906, from 622416 to 622445 (30 bp); Gordonia polyisoprenivorans VH2 CGGCGAAGGCGACGCCGACGACGACGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 621545-622702	Sequence	GPOL_c05250 - signal transduction histidine kinase-like protein (Protein is coded in complementary strand; from 622702 to 621545)