Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4381497
End position: 4381526
Length: 30

DNA sequence
>NC_016906, from 4381497 to 4381526 (30 bp); Gordonia polyisoprenivorans VH2 GCATCGGCATCGACATCGGCATCGGCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4380234-4382297	Sequence	GPOL_c38410 - putative transmembrane protein (Protein is coded in complementary strand; from 4382297 to 4380234)