Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3565345
End position: 3565374
Length: 30

DNA sequence
>NC_016906, from 3565345 to 3565374 (30 bp); Gordonia polyisoprenivorans VH2 GGGCCGGGATGGCCCGGAATGTGCCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3564006-3565547	Sequence	GPOL_c31580 - cell envelope-related transcriptional attenuator (Protein is coded in complementary strand; from 3565547 to 3564006)