Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 513179
End position: 513205
Length: 27

DNA sequence
>NC_016906, from 513179 to 513205 (27 bp); Gordonia polyisoprenivorans VH2 TGGCGGCGATCGCGGCGATGGCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 511645-514980	Sequence	GPOL_c04300 - cell wall arabinan synthesis protein (Protein is coded in complementary strand; from 514980 to 511645)