Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 5007798
End position: 5007824
Length: 27

DNA sequence
>NC_016906, from 5007798 to 5007824 (27 bp); Gordonia polyisoprenivorans VH2 CGGCCAGTTCGGTCAGTTCGGACAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5006132-5008678	Sequence	GPOL_c44110 kdpD two component system sensor kinase KdpD (Protein is coded in complementary strand; from 5008678 to 5006132)