Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4761018
End position: 4761044
Length: 27

DNA sequence
>NC_016906, from 4761018 to 4761044 (27 bp); Gordonia polyisoprenivorans VH2 CAACACCACCAGCACCACCGACACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4760149-4761117	Sequence	GPOL_c41860 - hypothetical protein (Protein is coded in complementary strand; from 4761117 to 4760149)