Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4730314
End position: 4730340
Length: 27

DNA sequence
>NC_016906, from 4730314 to 4730340 (27 bp); Gordonia polyisoprenivorans VH2 GGTCGAGGTGGTCGACGTGGTCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4729352-4730449	Sequence	GPOL_c41570 - putative esterase (Protein is coded in complementary strand; from 4730449 to 4729352)